Re: YP355 result is back

From: Michael Cooley <michael_at_newsummer.com>
Date: Fri, 13 Jun 2014 02:04:42 -0500

And, FYI, the R1a tree has just been update. Scroll down:

http://www.familytreedna.com/public/R1a/

Nothing new in our direct line, but the "family" is being fleshed out.

-Michael

On Fri, June 13, 2014 1:36 am, Michael Cooley wrote:
> I'm positive for it (meaning the call yielded "A"! YSEQ was a breeze to
> work with.
>
> --quote--
> YP355
> [YP355]
> HG19 Position: ChrY:15318528..15318528
> Ancestral: T
> Derived: A
> Reference: YFull (2014)
> ISOGG Haplogroup: R1a1a1b1a3a (not listed)
> Comments: Downstream of L448. parallel to CTS4179
> Forward Primer: YP355_F GCCTGGGATAAGACAGTTGC
> Reverse Primer: YP355_R TCGGATGTGTGCATTTTAGC
> --endquote--
>
>
> -Michael
>
>


-- 
VP, the Cooley Family Association of America
Administrator, the Akins DNA Project
Administrator, the Ashenhurst DNA Project
Administrator, the Bishop DNA Project
Administrator, the Eldridge DNA Project
Administrator, the Fisk DNA Project
Administrator, the alt-McDowell DNA Project
Co-Administrator, the Cooley DNA Project
Co-Administrator, the McDougall DNA Project
Co-Administrator, the Pickens DNA Project
Co-Administrator, the Strother DNA Project
Instructor, the Osher Lifelong Learning Institute (OLLI)
B.A. Humboldt State University, History
Received on Fri Jun 13 2014 - 02:04:42 CDT

This archive was generated by hypermail 2.3.0 : Fri Jun 13 2014 - 02:04:52 CDT